View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9264A_low_535 (Length: 228)

Name: NF9264A_low_535
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9264A_low_535
NF9264A_low_535
[»] scaffold0036 (2 HSPs)
scaffold0036 (1-223)||(21775-21997)
scaffold0036 (1-224)||(13736-13959)


Alignment Details
Target: scaffold0036 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: scaffold0036
Description:

Target: scaffold0036; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 21997 - 21775
Alignment:
1 taccttttgcttcacctttgaagatataacaaaattccctaattttgtgtttcattttacgagagctgatgttacccttaaacctcagaacttagttgtt 100  Q
    |||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21997 taccttttgcttcacctttggagatataacaaagttccctaattttgtgtttcattttacgagagctgatgttacccttaaacctcagaacttagttgtt 21898  T
101 aaggttggcaacaactcgtattgcttgtttgttgtaccaaataaaggtatttccatctttggaaatagagcacaatttaattttttagttgggtacgatc 200  Q
     || |||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21897 gagcttggcaaccactcgtattgcttgtttgtcgtaccaaataaaggtatttccatctttggaaatagagcacaatttaattttttagttgggtacgatc 21798  T
201 tcaaaggaaaaacagtttccttt 223  Q
    |||||||||||||||||||||||    
21797 tcaaaggaaaaacagtttccttt 21775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0036; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 13959 - 13736
Alignment:
1 taccttttgcttcacctttgaagatataacaaaattccctaattttgtgtttcattttacgagagctgatgttacccttaaacctcagaacttagttgtt 100  Q
    |||||||||||||||||||| |||| || |||| ||||||||||| ||||||||||| ||| |||| ||||||||||||||||||||||| ||| ||| |    
13959 taccttttgcttcacctttggagatctagcaaagttccctaatttcgtgtttcatttcacgggagccgatgttacccttaaacctcagaaattacttggt 13860  T
101 aaggttggcaacaactcgtattgcttgtttgttgtaccaaataaaggtatttccatctttggaaatagagcacaatttaattttttagttgggtacgatc 200  Q
        ||||||||||||||||||||||||| |   |||||   || | | |||||||||||||||||| ||||||  || ||||| |||| |  || ||||    
13859 gttcttggcaacaactcgtattgcttgttggccataccatccaatgatctttccatctttggaaatatagcacacgttgattttctagtagaatatgatc 13760  T
201 tcaaaggaaaaacagtttcctttg 224  Q
    || |||| |||| |||||||||||    
13759 tcgaagggaaaaaagtttcctttg 13736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University