View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_541 (Length: 227)
Name: NF9264A_low_541
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_541 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 6 - 227
Target Start/End: Original strand, 3015575 - 3015793
Alignment:
| Q |
6 |
aaaggattcaaggaaatggacttgttatgtcatacttcttgctatcgtcctcgtcatcgtgctcctgtttccattgttgatgtcaattctacctcacttg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3015575 |
aaaggattcaaggaaatggacttgttatgtcatacttcttgctatcgtcctcgtcatcgtgctcctgtttccattgttgatgtcaattctacctcacttg |
3015674 |
T |
|
| Q |
106 |
tttctgtagagttaaaaggtcaaagtcgtcgtcgtcatcatcatcgttattaaacaaagaatcttagagagtattagattttatgtattctgatatgtca |
205 |
Q |
| |
|
|||||||||| ||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
3015675 |
tttctgtagaattaaaaggtcaaa---gtcgtcatcatcatcatcgttattaaacaaagaatcttagagagtattagattttatgcattctgaaatgtca |
3015771 |
T |
|
| Q |
206 |
aggaacatgctgcatgagctag |
227 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
3015772 |
aggaacatgctgcatgagctag |
3015793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University