View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_548 (Length: 225)
Name: NF9264A_low_548
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_548 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 75 - 225
Target Start/End: Original strand, 7617568 - 7617716
Alignment:
| Q |
75 |
gcaaagtgcactgtttttccatagtgtaaagccaatttcgctgctactttccggnnnnnnnnncactttaaagacagaacagaagcttataaaagcacac |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7617568 |
gcaaagtgcactgtttttccatagtgtaaagccaatttcgctgctactttccggttttttt--cactttaaagacagaacagaagcttataaaagcacac |
7617665 |
T |
|
| Q |
175 |
cctattggcttcacacattcattgcaatcacaagcatcattgatttcttat |
225 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
7617666 |
cctattggcttcacacattcattgaaatcacatgcatcattgatttcttat |
7617716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University