View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9264A_low_553 (Length: 224)

Name: NF9264A_low_553
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9264A_low_553
NF9264A_low_553
[»] chr1 (1 HSPs)
chr1 (21-189)||(42793550-42793722)


Alignment Details
Target: chr1 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 21 - 189
Target Start/End: Complemental strand, 42793722 - 42793550
Alignment:
21 attcgtatcccttatcccttagctgttgagtgaaaatccctcatgttggtgcattgtgatggaccaaccagatacttattttagcgatgctttgaatcnn 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      
42793722 attcgtatcccttatcccttagctgttgagtgaaaatccctcatgttggtgcattgtgatggaccaaccagatacttattttagcgatgctttgaatcaa 42793623  T
121 nnnnnngatcagaacgagagttgccatgcc--atttaag--ctttcttttttccatatcaatgccaagtaaca 189  Q
          ||||||||| ||||||||||||||  |||||||   ||| |||||||||||||||||| | ||||||    
42793622 aaaaaagatcagaacaagagttgccatgccttatttaagtctttttttttttccatatcaatgctatgtaaca 42793550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University