View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_553 (Length: 224)
Name: NF9264A_low_553
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_553 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 21 - 189
Target Start/End: Complemental strand, 42793722 - 42793550
Alignment:
| Q |
21 |
attcgtatcccttatcccttagctgttgagtgaaaatccctcatgttggtgcattgtgatggaccaaccagatacttattttagcgatgctttgaatcnn |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42793722 |
attcgtatcccttatcccttagctgttgagtgaaaatccctcatgttggtgcattgtgatggaccaaccagatacttattttagcgatgctttgaatcaa |
42793623 |
T |
|
| Q |
121 |
nnnnnngatcagaacgagagttgccatgcc--atttaag--ctttcttttttccatatcaatgccaagtaaca |
189 |
Q |
| |
|
||||||||| |||||||||||||| ||||||| ||| |||||||||||||||||| | |||||| |
|
|
| T |
42793622 |
aaaaaagatcagaacaagagttgccatgccttatttaagtctttttttttttccatatcaatgctatgtaaca |
42793550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University