View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_554 (Length: 224)
Name: NF9264A_low_554
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_554 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 18 - 206
Target Start/End: Complemental strand, 1610674 - 1610486
Alignment:
| Q |
18 |
aaagagcaaaatggcggcagtttcttggagagaatgtttaatgagggtagaatggaagatattcaaatgatatttaatgagatcattggtcatgtggtcg |
117 |
Q |
| |
|
||||| |||||||||||||| |||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1610674 |
aaagatcaaaatggcggcaggttcttgcagagaatgtttgatgagggtagaatggaagatattcaaatgatatttaatgagatcattggtcatgtggtcg |
1610575 |
T |
|
| Q |
118 |
aacttatgatgagtccttttggaaattatcttatacagaggtttttggatgtatgtagtgaagagcagaggatgcagatcatactgatg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1610574 |
aacttatgatgagtccttttggaaattatcttatacggaagttgttggatgtatgtagtgaagagcagaggatgcagatcatactgatg |
1610486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University