View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_560 (Length: 221)
Name: NF9264A_low_560
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_560 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 410384 - 410164
Alignment:
| Q |
1 |
gagaggcatgtgaagtgagatgaaatcagcggttgtgattgcttgatcaaatgagactaattccacaccaacagcacgtgctctatcagctggagcataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
410384 |
gagaggcatgtgaagtgagatgaaatcagcggttgtgattgcttgatcaaatgaaactaattccacaccaacagcacgtgctctatcagctggagcataa |
410285 |
T |
|
| Q |
101 |
gggtcatgagcaatcacattcattcctaatccttttgcacgccttgcaacttcagatccaacttttccaaatcccattattgctaatgttttcccaacca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
410284 |
gggtcatgagcaatcacattcattcctaatccttttgcacgccttgcaacttcagatccaacttttccaaaccccattattgctaatgttttcccaacca |
410185 |
T |
|
| Q |
201 |
tagatactcccacatacttgc |
221 |
Q |
| |
|
|||||||||| |||||||||| |
|
|
| T |
410184 |
tagatactccaacatacttgc |
410164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 85 - 179
Target Start/End: Complemental strand, 48785548 - 48785454
Alignment:
| Q |
85 |
atcagctggagcataagggtcatgagcaatcacattcattcctaatccttttgcacgccttgcaacttcagatccaacttttccaaatcccatta |
179 |
Q |
| |
|
|||||| ||||||||||| ||||||||||| || ||||| || | || || |||||||| ||||| |||| |||||| || ||||||||||||| |
|
|
| T |
48785548 |
atcagcaggagcataaggatcatgagcaataaccttcataccaagccccttagcacgcctagcaacctcagttccaaccttcccaaatcccatta |
48785454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University