View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_561 (Length: 221)
Name: NF9264A_low_561
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_561 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 17 - 221
Target Start/End: Complemental strand, 22362307 - 22362100
Alignment:
| Q |
17 |
gattattctccgctcaaaatacctgatatcggtgtttttcacgtcaatctcaccgcggtatgcaaacaaacaagaccttacatattttaaccatgatct- |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
22362307 |
gattattctccgctcaaaatacctgatatcggtgtttttcacgtcaatctcaccgcggtatgcaaacaaacaagaccttacatattttaaccatgatatt |
22362208 |
T |
|
| Q |
116 |
--tgctgggttcttattcatcttttctttttcatgcgttgtgtatgttagggatcaatgatggcaccacatgtgaatccaagtgcaacagaatataccat |
213 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
22362207 |
gctgctgggttcttattcatcttttctatttcatgcattgtgtatgttagggatcaatgatggcaccacatgtgaatccaagtgcaacagagtataccat |
22362108 |
T |
|
| Q |
214 |
agtattaa |
221 |
Q |
| |
|
|||||||| |
|
|
| T |
22362107 |
agtattaa |
22362100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University