View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_564 (Length: 219)
Name: NF9264A_low_564
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_564 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 114 - 219
Target Start/End: Complemental strand, 21831854 - 21831749
Alignment:
| Q |
114 |
ctttgtagaccgataaaaacatcaatgaggacattagatctcaaacatggtattaatggagtgatcaaataccacgatcgctttcgaggagggcacttgg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21831854 |
ctttgtagaccgataaaaacatcaatgaggacattagatctcaaacatggtattaatggagtgatcaaataccacgatggctttcgaggagggcacttgg |
21831755 |
T |
|
| Q |
214 |
atacca |
219 |
Q |
| |
|
|||||| |
|
|
| T |
21831754 |
atacca |
21831749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University