View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_573 (Length: 218)
Name: NF9264A_low_573
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_573 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 9 - 207
Target Start/End: Original strand, 36723909 - 36724107
Alignment:
| Q |
9 |
atggacatcaacaacaacaatgaaaattctttttggcaatttagtgatcaactaaggcatcaaacatcaaatttggctaatctatcactaaatgattcaa |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36723909 |
atggacatcaacaacaacaatgaaaattctttttggcaatttagtgatcaactaaggcatcaaacatcaaatttggctagtctatcactaaatgattcaa |
36724008 |
T |
|
| Q |
109 |
tttggagcaccaacatgaccaaaagacctgatcaaagaagaaactttgatgtcaaaaattctgatatcaacaactccttcactaatttcaacacgaaac |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36724009 |
tttggagcaccaacatgaccaaaagacctgatcaaagaagaaactttgatgtcaaaaattctgatatcaacaactccttcactaatttcaactcgaaac |
36724107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University