View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_599 (Length: 213)
Name: NF9264A_low_599
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_599 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 22 - 195
Target Start/End: Complemental strand, 26597857 - 26597684
Alignment:
| Q |
22 |
ctccacgccctaacatcatcatctcatactggttttgatgtgtctgtggatgagtagtagttaacaaagctgtcagattccggtgaccggagaaaaactc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26597857 |
ctccacgccctaacatcatcatctcatactggttttgatgtgtctgtggatgagtagtagttaacaaagctgtcagattccggtgaccggagaaaaactc |
26597758 |
T |
 |
| Q |
122 |
atccgtagccgctgtcggtatagatgggaaatgggttgaccttgttccatttactagctgtcttagatcatatt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26597757 |
atccgtagccgctgtcggtatagatgggaaatgggttgaccttgttccatttactagctgtcttagatcatatt |
26597684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University