View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_609 (Length: 209)
Name: NF9264A_low_609
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_609 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 5e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 17 - 209
Target Start/End: Original strand, 34344744 - 34344936
Alignment:
| Q |
17 |
agaatatccaaggtggctccaaatttgtctttgaaggaggatgcaaaggtttgaatagaatcagcatctgagacatcaaggactagaaagtgaacatgat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34344744 |
agaatatccaaggtggctccaaatttgtctttgaaggaggatgcaaaggttttaatagaatcagcatctgagacatcaaggactagaaagtgaacatgat |
34344843 |
T |
 |
| Q |
117 |
gatgaggtgcaacaaggcctaattgtgctcgaatcatctccacagcatcctctcctttcttcttgtctctagcagttaacactacactcagtc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34344844 |
gatgaggtgcaacaaggcctaattgtgctcgaattctctccacagcatcctctcctttcttcttgtctctagcagttaacactacactcagtc |
34344936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University