View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_610 (Length: 209)
Name: NF9264A_low_610
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_610 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 86 - 190
Target Start/End: Complemental strand, 13117100 - 13116996
Alignment:
| Q |
86 |
tttgctcagcaaaattagttctcacattagagacaaaaaatataatacaatcatcatacaagagtcatattgctcaagttctttcaatagtatataacac |
185 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
13117100 |
tttgctcagcaacattagttctcacattagagacaaaaaatataatacaattatcatacaagagtcatattgctcaagttcttacaatagtatataagac |
13117001 |
T |
 |
| Q |
186 |
gtatt |
190 |
Q |
| |
|
||||| |
|
|
| T |
13117000 |
gtatt |
13116996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University