View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_612 (Length: 209)
Name: NF9264A_low_612
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_612 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 21 - 195
Target Start/End: Complemental strand, 22582060 - 22581886
Alignment:
| Q |
21 |
gctaaattatactcaaaagttgccgacgtatctttgtttttcaccctattaaatttttatatttggaggctaattggtccttttttctggtttaattatc |
120 |
Q |
| |
|
||||||||||||||||||| ||| || ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
22582060 |
gctaaattatactcaaaagatgctgatgtatctttgtttttcaccctatttaatttttatatttggaggctaattggtcctttgttctggtttaattatc |
22581961 |
T |
|
| Q |
121 |
aggacaagcctgagccaccaccagagggtcgcttgcctgatgccaccaagggttagtgttctggacttgtgatgt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
22581960 |
aggacaagcctgagccaccaccagagggtcgcttgcctgatgccaccaagggtaagtgttctggacttgcgatgt |
22581886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 121 - 174
Target Start/End: Complemental strand, 1780544 - 1780491
Alignment:
| Q |
121 |
aggacaagcctgagccaccaccagagggtcgcttgcctgatgccaccaagggtt |
174 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| ||| |||||| |
|
|
| T |
1780544 |
aggacaagcctgagccaccattagagggtcgcttgcctgatgctaccgagggtt |
1780491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 128 - 194
Target Start/End: Original strand, 12348652 - 12348718
Alignment:
| Q |
128 |
gcctgagccaccaccagagggtcgcttgcctgatgccaccaagggttagtgttctggacttgtgatg |
194 |
Q |
| |
|
|||||||||||||||||| | |||||| | |||||| || ||||||||||||||| || |||||||| |
|
|
| T |
12348652 |
gcctgagccaccaccagatgatcgctttcttgatgcaacaaagggttagtgttcttgatttgtgatg |
12348718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 131 - 194
Target Start/End: Original strand, 25282354 - 25282417
Alignment:
| Q |
131 |
tgagccaccaccagagggtcgcttgcctgatgccaccaagggttagtgttctggacttgtgatg |
194 |
Q |
| |
|
||||||||||||||| | |||||| | |||||| || ||||||||||||||| || |||||||| |
|
|
| T |
25282354 |
tgagccaccaccagatgatcgctttcttgatgcaacaaagggttagtgttcttgatttgtgatg |
25282417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University