View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_613 (Length: 208)
Name: NF9264A_low_613
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_613 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 7e-85; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 26 - 188
Target Start/End: Complemental strand, 885693 - 885531
Alignment:
| Q |
26 |
atgaatgagttggagagggagagtttgtaggaatgcattaattgcttctaccttttgttaactagtatttctattactatatgtggaatatatggattat |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
885693 |
atgaatgagttggagagggagagtttgtaggaatgcattaattgcttctaccttttgttaactagtatttctattactatatgtggaatatatggattat |
885594 |
T |
|
| Q |
126 |
gcatttcaaggcctaataaaaggggaaaatctagttcatcttacattttgttaatgtacataa |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
885593 |
gcatttcaaggcctaataaaaggggaaaatctagttcatctttcattttgttaatgtacataa |
885531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 121 - 172
Target Start/End: Complemental strand, 1849159 - 1849107
Alignment:
| Q |
121 |
attatgcatttcaaggcctaataaaaggg-gaaaatctagttcatcttacatt |
172 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||| |||||||||||| |||| |
|
|
| T |
1849159 |
attatgcatttcaaggcctaatataagggaaaaaaactagttcatctttcatt |
1849107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University