View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264A_low_630 (Length: 204)
Name: NF9264A_low_630
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264A_low_630 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 21 - 185
Target Start/End: Original strand, 47137120 - 47137284
Alignment:
| Q |
21 |
attacccggcattaaagatgatgggaggtagaagatatatnnnnnnnngatcttcactaaaaactagtagatgcgagcttttaccaccacttatccacat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47137120 |
attacccggcattaaagatgatgggaggtagaagatatataaaaaaaagatcttcactaaaaactagtagatgcgagcttttaccaccacttatccacaa |
47137219 |
T |
 |
| Q |
121 |
aataaccacaccggtgcatagaccctgatcaaagcaatccacacgaaatttagtcaccaccatac |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47137220 |
aataaccacaccggtgcatagaccctgatcaaagcaatccacatgaaatttagtcaccaccatac |
47137284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University