View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9264A_low_636 (Length: 202)

Name: NF9264A_low_636
Description: NF9264A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9264A_low_636
NF9264A_low_636
[»] chr3 (1 HSPs)
chr3 (15-55)||(30344345-30344385)


Alignment Details
Target: chr3 (Bit Score: 37; Significance: 0.000000000004; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 15 - 55
Target Start/End: Complemental strand, 30344385 - 30344345
Alignment:
15 gtttcgtgttttaatgttacttaattttccaaacaatgtct 55  Q
    ||||| |||||||||||||||||||||||||||||||||||    
30344385 gtttcatgttttaatgttacttaattttccaaacaatgtct 30344345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University