View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264_high_23 (Length: 482)
Name: NF9264_high_23
Description: NF9264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264_high_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 197 - 465
Target Start/End: Original strand, 44111651 - 44111920
Alignment:
| Q |
197 |
ggtttttgtagtggaacttgggtgtttt-tcaaaattggtgctttatcatcttacatgtagttattgtcatcatgtcttccaagagaaaccttccatcat |
295 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44111651 |
ggtttttgcagtggaacttgggtgttttttcaaaattggtgctttatcatcttacatgtagttattgtcatcatgtcttccaagagaaaccttccatcat |
44111750 |
T |
|
| Q |
296 |
ggatgacttcaaatgatgatgatggtcatggaaattttggaaagagaccaactttggatgaaggtggtgagaaatccagtgaaattgggacttccaacaa |
395 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44111751 |
ggatgacttcaaatgatgatgatggtcatggaaattttggaaagagaccaactttggatgaaggtggtgagaaatccagtgaaattgggacttccaacaa |
44111850 |
T |
|
| Q |
396 |
gaagaccaaagttgaaaatgaaaatgctttcaacaagcttatggtaattgattaagtttatgtttgctat |
465 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44111851 |
gaagaccaaagttgaaaatgaaaatgctttcaacaagcttatggtaattgattaagtttatgtttgctat |
44111920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University