View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264_high_26 (Length: 460)
Name: NF9264_high_26
Description: NF9264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264_high_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 3e-46; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 37320760 - 37320878
Alignment:
| Q |
1 |
ataggagtacaattaaattgtaccaaaaataatacaattaaatttgaattaaactaaattgaaactctttttatagagtcttcttaaggatgggataaag |
100 |
Q |
| |
|
|||| |||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37320760 |
atagaagtacaattaaattgtgccaaaaaaaatacaattaaatttgaattaaactaaattgacactccctttatagagtcttcttaaggatgggataaag |
37320859 |
T |
 |
| Q |
101 |
actcgaataggatataata |
119 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
37320860 |
actcgaataggatataata |
37320878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University