View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264_high_41 (Length: 351)
Name: NF9264_high_41
Description: NF9264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264_high_41 |
 |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0007 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 1 - 332
Target Start/End: Complemental strand, 250332 - 250001
Alignment:
| Q |
1 |
aaaacatctcttctttttcttcttgctcaaacaacctccacctatatttatttcccaatcacaattgttgcggccgtctcggtcttcatcatatacgtta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
250332 |
aaaacatctcttctttttcttcttgctcaaacaacctccacctatatttatttcccaatcacaattgttgcggccgtctcggtcttcatcatatacgtta |
250233 |
T |
 |
| Q |
101 |
agataatgacggcgagggtcgctaggccatctaaagctgcagaagaataacgtagttttaaaaataatcactgatggtttaaatgaaaatgtgtaacttc |
200 |
Q |
| |
|
||||||||||||||| |||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
250232 |
agataatgacggcgatggtcactaggccatgtaaagctgcagaagaataacgtagttttaaaaataatcacagatggtttaaatgaaaatgtgtaacttc |
250133 |
T |
 |
| Q |
201 |
ctccgtattggacattgtgaactttaagatcgttatctctagattggcaacgtaatatgaaaaatggtgccggtaattgattgataattgtaactgttac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
250132 |
ctccgtattggacattgtgaactttaagatcgttatctctagattggcaacgtaatatgaaaaatggtgccggtaattgattgataattgtaactgttac |
250033 |
T |
 |
| Q |
301 |
tctaacagctatagtctctgtggcctcaaatg |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
250032 |
tctaacagctatagtctctgtggcctcaaatg |
250001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University