View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9264_high_66 (Length: 254)

Name: NF9264_high_66
Description: NF9264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9264_high_66
NF9264_high_66
[»] chr5 (1 HSPs)
chr5 (13-99)||(27534702-27534788)


Alignment Details
Target: chr5 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 13 - 99
Target Start/End: Original strand, 27534702 - 27534788
Alignment:
13 agcagagatattacgatgttcgagacaattatgcaattttgtaagcataattgtaatttatttatgggttatactaacaagtgccct 99  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
27534702 agcatagatattacgatgttcgagacaattatgcaattttgtaagcataattgtaatttatttatgggttatgctaacaagtgccct 27534788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University