View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264_high_70 (Length: 241)
Name: NF9264_high_70
Description: NF9264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264_high_70 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 40 - 241
Target Start/End: Complemental strand, 35045701 - 35045500
Alignment:
| Q |
40 |
ctttcttagtagacaatccactatacattgcacccttcaaaaataaatccactacacattgtacggttatatatatacgggggttggctttcgtcttgta |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
35045701 |
ctttcttagtagacaatccactatacattgcacccttcaaaaataaatccactacacattgtacggttatatatatacgggggttggctttcgtctcata |
35045602 |
T |
 |
| Q |
140 |
ctattcaacactactcnnnnnnnnatcgtcattgcttacatttctcttggtttttgtctttgacaacattaattcccataaattcatcatctaaatgttt |
239 |
Q |
| |
|
||||||| ||||| || |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35045601 |
ctattcagcactagtcttttttttatcgtcattgcttacatttctcctggtttttgtctttgacaacattaattcccataaattcatcatctaaatgttt |
35045502 |
T |
 |
| Q |
240 |
tt |
241 |
Q |
| |
|
|| |
|
|
| T |
35045501 |
tt |
35045500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University