View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264_high_71 (Length: 239)
Name: NF9264_high_71
Description: NF9264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264_high_71 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 16 - 227
Target Start/End: Original strand, 9165227 - 9165438
Alignment:
| Q |
16 |
cagtctcatgggttaggttcctaaagctgggtcaaatcgtaactcaagtaacagataaacaagggtaactgataagagtttgctcagatagaccatttac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9165227 |
cagtctcatgggttaggttcctaaagctgggtcaaatcgtaactcaactaacagataaacaagggtaactgataagagtttgctcagatagaccatttac |
9165326 |
T |
|
| Q |
116 |
ctccaaatctctcccaatggtttggcctatagtttcctttgtctatcttttactattaaattatctttcatctagtcaaccctccttatggaggataaaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9165327 |
ctccaaatctctcccaatggtttggcctatagtttcctttgtctatcttttactattaaattatctttcatctagtcaaccctccttatggaggataaaa |
9165426 |
T |
|
| Q |
216 |
gtccaaaaatac |
227 |
Q |
| |
|
|||||||||||| |
|
|
| T |
9165427 |
gtccaaaaatac |
9165438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University