View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264_low_115 (Length: 284)
Name: NF9264_low_115
Description: NF9264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264_low_115 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 185
Target Start/End: Original strand, 36887851 - 36888031
Alignment:
| Q |
1 |
tgagaagcaggtaaaggaagttacgaatcatttttctgagaattggaagaaactattaacaatactctttgttcttcttttcctgaaaaatacacagaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36887851 |
tgagaagcaggtaaaggaagttacgaatcatttttctgagaattggaa---actattaacaatgctctttgttcttcttttcctgaaaa-tacacagaga |
36887946 |
T |
 |
| Q |
101 |
gatagcatcagtgaattttctttgcgttttcattggttttcgaagttgagaagcaaatgtagaattacaatgtgttgtttcttgc |
185 |
Q |
| |
|
||||||| ||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
36887947 |
aatagcataagtgaattttcattgcgttttcatcggttttcgaagttgagaagcaaatgtagaattaccatgtgtagtttcttgc |
36888031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University