View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9264_low_119 (Length: 279)

Name: NF9264_low_119
Description: NF9264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9264_low_119
NF9264_low_119
[»] chr3 (1 HSPs)
chr3 (19-262)||(44546938-44547176)


Alignment Details
Target: chr3 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 19 - 262
Target Start/End: Complemental strand, 44547176 - 44546938
Alignment:
19 cccccgacattcacacaatcggtgcatcgctaactgttagatgggatcaagatctgaaccatttggtctcgatccaacggttaccgatgggctgactgga 118  Q
    |||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44547176 cccccgacat-cacacaatcagtgcatcgctaactgttagatgggatcaagatctgaaccatttggtctcgatccaacggttaccgatgggctgactgga 44547078  T
119 agcaatggcattcgaatagatagtacatacacatcataaaagaaagataaaatgtggactattagnnnnnnnnnnnnttgacaaatataagattgcatat 218  Q
    ||||||| |||||||    ||||||||||||||||||||||||||||||||||||||||||||||            ||||||||| |||||||||||||    
44547077 agcaatgacattcga----atagtacatacacatcataaaagaaagataaaatgtggactattagaaaaaagaaaaattgacaaatttaagattgcatat 44546982  T
219 taccaagctttccacattaattatatcaatcacatcatcaccat 262  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
44546981 taccaagctttccacattaattatatcaatcacatcatcaccat 44546938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University