View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9264_low_132 (Length: 268)

Name: NF9264_low_132
Description: NF9264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9264_low_132
NF9264_low_132
[»] chr4 (1 HSPs)
chr4 (1-248)||(24260728-24260976)


Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 24260976 - 24260728
Alignment:
1 ttataaactcatgatcaccgataactatcttcaaaattggataaagtgaggtgatatat-ggaaaccatgtacgacctaatcagacatgttattaaaaac 99  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
24260976 ttataaactcatgatcaccgataactatcttcaaaattggataaagtgaggtgatatattggaaaccatgtacgacctaatcagacatgttattaaaaac 24260877  T
100 tataaaattagaaatcattgtatcacatcatgatataatgtcgaatagatatgccataaaatggacattaattcatgataaacttctgaactgcaacaaa 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24260876 tataaaattagaaatcattgtatcacatcatgatataatgtcgaatagatatgccataaaatggacattaattcatgataaacttctgaactgcaacaaa 24260777  T
200 gaagtttaaacactaaaactacgataacactgtcactacacaattttaa 248  Q
    ||| |||||||||||||||| ||| |||||| ||||||| |||||||||    
24260776 gaaatttaaacactaaaactgcgacaacactatcactacgcaattttaa 24260728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University