View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264_low_142 (Length: 250)
Name: NF9264_low_142
Description: NF9264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264_low_142 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 9 - 211
Target Start/End: Complemental strand, 43212836 - 43212634
Alignment:
| Q |
9 |
agattatactgaaattaaataccgtcaatcaatttagtgtctacattaatcaattcaatgaatgggaagtgaaagtcgctcattcataccaagaggtaaa |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43212836 |
agattatactgaaattaaataccgtcaatcaatttagtgtctacattaatcaattcaatgaatgggaagtgaaggtcgctcattcataccaagaggtaaa |
43212737 |
T |
 |
| Q |
109 |
tcaatgctttgatgcgcttgcaaatttaggatgctctttgaataaccctgtgatgttttatggatcatgtccaactcatattaggaatttgtttgtaact |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43212736 |
tcaatgctttgatgcgcttgcaaatttaggatgctctttgaataaccctgtgatgttctatggatcatatccaactcatattaggaatttgtttgtaact |
43212637 |
T |
 |
| Q |
209 |
gat |
211 |
Q |
| |
|
||| |
|
|
| T |
43212636 |
gat |
43212634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 206 - 250
Target Start/End: Complemental strand, 43212574 - 43212530
Alignment:
| Q |
206 |
actgatctagggtgttttttaaaatatcaagtataacaggatggt |
250 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43212574 |
actgatctagggtgtttttttaaatatcaagtataacaggatggt |
43212530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University