View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264_low_143 (Length: 250)
Name: NF9264_low_143
Description: NF9264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264_low_143 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 8 - 136
Target Start/End: Complemental strand, 10470095 - 10469967
Alignment:
| Q |
8 |
ttggtggtcgtgaagttaatcctgtttgggaactcgctgatcaacataatctcaaaacgtgcttttctgattatagcaatgctcgcttcaacatctatga |
107 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10470095 |
ttggaggtcgtgaagctaatcctgtttgggaactcgctgttcaacataatctcaaaacgtgcttttctgattatagcaatgctcgcttcaacatctatga |
10469996 |
T |
 |
| Q |
108 |
tcaaaggttcgtgaaattcatcacattca |
136 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10469995 |
tcaaaggttcgtgaaattcatcacattca |
10469967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 185 - 246
Target Start/End: Complemental strand, 10469918 - 10469857
Alignment:
| Q |
185 |
acggtaatagttagttacggttacgattcgtagtgtagacgacgtcgtttcgatcggtgctg |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10469918 |
acggtaatagttagttacggttacgattcgtagtgtagacgacgtcgtttcaatcggtgctg |
10469857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University