View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264_low_154 (Length: 228)
Name: NF9264_low_154
Description: NF9264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264_low_154 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 75 - 228
Target Start/End: Original strand, 47036729 - 47036881
Alignment:
| Q |
75 |
cactttgcaattttagttctgaagcacccttttcatcataaaagatagatnnnnnnncaaaagaaagatatgactttggtccannnnnnncttcctttat |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47036729 |
cactttgcaattttagttctgaagcacccttttcatcataaaagatagataaaaaaacaaaagaaagatatgactttggtccatttttt-cttcctttat |
47036827 |
T |
 |
| Q |
175 |
aagcaagatggctatggtcctatggaggagaagagagcattcacatgacaaccg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47036828 |
aagcaagatggctatggtcctatggaggagaagagagcattcacatgacaaccg |
47036881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University