View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9264_low_28 (Length: 572)
Name: NF9264_low_28
Description: NF9264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9264_low_28 |
 | |
|
| [»] scaffold0028 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0028 (Bit Score: 286; Significance: 1e-160; HSPs: 2)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 123 - 432
Target Start/End: Original strand, 125764 - 126073
Alignment:
| Q |
123 |
actgagtttgcaaggagaagatttgaaaagagagtttctctttctcagcaagtgtaagtacaactcaagtgacatatgctttattcaaaacaccttttca |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
125764 |
actgagtttgcaaggagaagatttgaaaagagagtttctctttctcagcaagtgtaagtacaactgaagtgacatatgctttattcaaaacaccttttca |
125863 |
T |
|
| Q |
223 |
aaatcttttgttggatttccctgctttccctcccttacggaagttgaagccttttctcctttggaaccctctctttaactcaaatgctcacgtgtcactt |
322 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
125864 |
aaatcttttgttggatttccatgctttccctcccttacggaagttgaagccttttctcctttggaaccctctctttaactcaaatgctcacgtgtcactt |
125963 |
T |
|
| Q |
323 |
aatggagctgtccacttgtcaaacaaagccgcagccaattgtcacacatacaggaagccagatgtcatgcctgaaggaagcaggtattctcttcttatat |
422 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
125964 |
aatggagctgtccacttgtcaaacaaagccgcagccaattgtcacacatataggaaaccaaatgtcatgcctggaggaagcaggtattctcttcttatat |
126063 |
T |
|
| Q |
423 |
tataggagat |
432 |
Q |
| |
|
|||||||||| |
|
|
| T |
126064 |
tataggagat |
126073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 19 - 50
Target Start/End: Original strand, 125657 - 125688
Alignment:
| Q |
19 |
ttatgcttagaaatggaactgaaaaataaatg |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
125657 |
ttatgcttagaaatggaactgaaaaataaatg |
125688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 56; Significance: 6e-23; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 431 - 486
Target Start/End: Original strand, 33649027 - 33649082
Alignment:
| Q |
431 |
atttaaaattgctaacggtggcccaaaaacacatgttaattaattaaatagatgaa |
486 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33649027 |
atttaaaattgctaacggtggcccaaaaacacatgttaattaattaaatagatgaa |
33649082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University