View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9265_high_23 (Length: 252)
Name: NF9265_high_23
Description: NF9265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9265_high_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 20 - 237
Target Start/End: Original strand, 41593018 - 41593235
Alignment:
| Q |
20 |
gttcttactgtaagtggagaggctatttctaaataaatggtttatgcaatataatttcttttgtcctttcaaaaaatataatttgttttgtgtcaatttt |
119 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41593018 |
gttcttaccgtaagtggagaggctatttctaaataaatggtttatgcaatataatttcttttgtcctttcaaaaaatataatttgttttatgtcaatttt |
41593117 |
T |
 |
| Q |
120 |
gctttcgttcatgtgcattttaattgtctttaagtgatttgcagaagtttttccattggttgatgattgtgattcaattttatttttatcttttgcactt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41593118 |
gctttcgttcatgtgcattttaattgtctttaagtgatttgcagaagtttttccgttggttgatgattgtgattcaattttatttttatcttttgcactt |
41593217 |
T |
 |
| Q |
220 |
agtttgatggagaattat |
237 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
41593218 |
agtttgatggagaattat |
41593235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University