View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9265_high_30 (Length: 227)
Name: NF9265_high_30
Description: NF9265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9265_high_30 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 26 - 227
Target Start/End: Complemental strand, 40208021 - 40207817
Alignment:
| Q |
26 |
ttgcattgaaagttaatattgttcaaagttccatttcttc---ttgaatttatcgtcctattgtcagttatttgattgcttgttactctatatgatctat |
122 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40208021 |
ttgcattgaaagtgaatattgttcaaagttccatttctgcagcttgaatttatcgtcctattgtcagttatttgattgcttgttactctatatgatctat |
40207922 |
T |
 |
| Q |
123 |
gatatgtcaatattgtatacaaggggtgaacataatgctgattcatcagtagatcttgttggatttctagccaaatactctcaatggcctgtagtaacat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40207921 |
gatatgtcaatattgtatacaaggggtgaacataatgctgattcatcagtagatgttgttggatttctagccaaatactctcaatggcctgcagtaacat |
40207822 |
T |
 |
| Q |
223 |
tgggt |
227 |
Q |
| |
|
||||| |
|
|
| T |
40207821 |
tgggt |
40207817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University