View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9265_low_59 (Length: 236)
Name: NF9265_low_59
Description: NF9265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9265_low_59 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 14 - 232
Target Start/End: Original strand, 36349736 - 36349954
Alignment:
| Q |
14 |
gtttttcactttataaataccctttctttagccccctttactttactttcattttcttatatctctttgtccttaatattaattttctctccattttgtt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36349736 |
gtttttcactttataaataccctttctttagccccctttactttactttcattttcttatatctctttgtccttaatattaattttctctccattttgtt |
36349835 |
T |
|
| Q |
114 |
tcatcaccaaaaaggttagtgttattcagcaaaatattgaaacatcactttaaatcctttcacaatgatatctctcttttaggaaaaatcaaaccatttt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36349836 |
tcatcaccaaaaaggttagtgttattcagcaaaatattgaaacatcactttaaatcctttcacaatgatatctctcttttaggaaaaatcaaaccatttt |
36349935 |
T |
|
| Q |
214 |
cacctgaaaaccatgaaaa |
232 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
36349936 |
cacctgaaaaccatgaaaa |
36349954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University