View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9265_low_60 (Length: 236)

Name: NF9265_low_60
Description: NF9265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9265_low_60
NF9265_low_60
[»] chr8 (1 HSPs)
chr8 (14-232)||(36349736-36349954)


Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 14 - 232
Target Start/End: Original strand, 36349736 - 36349954
Alignment:
14 gtttttcactttataaataccctttctttagccccctttactttactttcattttcttatatctctttgtccttaatattaattttctctccattttgtt 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36349736 gtttttcactttataaataccctttctttagccccctttactttactttcattttcttatatctctttgtccttaatattaattttctctccattttgtt 36349835  T
114 tcatcaccaaaaaggttagtgttattcagcaaaatattgaaacatcactttaaatcctttcacaatgatatctctcttttaggaaaaatcaaaccatttt 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36349836 tcatcaccaaaaaggttagtgttattcagcaaaatattgaaacatcactttaaatcctttcacaatgatatctctcttttaggaaaaatcaaaccatttt 36349935  T
214 cacctgaaaaccatgaaaa 232  Q
    |||||||||||||||||||    
36349936 cacctgaaaaccatgaaaa 36349954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University