View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9265_low_68 (Length: 216)
Name: NF9265_low_68
Description: NF9265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9265_low_68 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 10 - 197
Target Start/End: Complemental strand, 5717030 - 5716839
Alignment:
| Q |
10 |
gaagcagagataaaaaactgagtcatccctcnnnnnnngaaacgagtcaaaaaatgcatatatacaaacatcacttacaaannnnnnnacactc----at |
105 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |||| | || |
|
|
| T |
5717030 |
gaagcatagataaaaaactgagtcatccctcaaaaaaagaaacgagtcaaaaaatgcatatatataaacatcacttacaaatttttttacacactcacat |
5716931 |
T |
 |
| Q |
106 |
ataataaaatcatttcatgttgtcatgcacttcaagttagctcttataaaagatcttgataaataccggtttggcataattcaattggataa |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5716930 |
ataataaaatcatttcatgttgtcatgcacttcaagttagctcttataaaagatcttgataaataccggtttggcataattcaattggataa |
5716839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University