View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9266_high_22 (Length: 280)
Name: NF9266_high_22
Description: NF9266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9266_high_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 32729129 - 32728867
Alignment:
| Q |
1 |
ttgttcaagtctcaaagaagacatttgctgaagaagtgaatgaggctttcagagacagtgcagccaaggagctgagtggtattctctcagtttgtgatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32729129 |
ttgttcaagtctcaaagaagacatttgctgaagaagtgaatgaggctttcagagacagtgcagccaaggagctgagtggtattctctcagtttgtgatga |
32729030 |
T |
|
| Q |
101 |
gccacttgtgtctgtagattttaggtgcactgatgtgtcctcaaccgtggattcgtcattgacaatggttatgggagatgacatggttaaggtgattgct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32729029 |
gccacttgtgtctgtagattttaggtgcactgatgtgtcctcaaccgtcgattcgtcattgacaatggttatgggagatgacatggttaaggtgattgct |
32728930 |
T |
|
| Q |
201 |
tggtatgataatgaatggggttactcacaaagggttgttgatttggctgacattgttgccaat |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32728929 |
tggtatgataatgaatggggttactcacaaagggttgttgatttggctgacattgttgccaat |
32728867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 93 - 224
Target Start/End: Complemental strand, 54181295 - 54181164
Alignment:
| Q |
93 |
tgtgatgagccacttgtgtctgtagattttaggtgcactgatgtgtcctcaaccgtggattcgtcattgacaatggttatgggagatgacatggttaagg |
192 |
Q |
| |
|
||||||| |||||||||||||| || || | ||||| ||||| || ||||| | || || || ||||| ||||| ||||||||||| ||||| |||| |
|
|
| T |
54181295 |
tgtgatgttccacttgtgtctgttgacttccgctgcaccgatgtttcttcaactattgactcttccttgactatggtcatgggagatgatatggtcaagg |
54181196 |
T |
|
| Q |
193 |
tgattgcttggtatgataatgaatggggttac |
224 |
Q |
| |
|
|| ||||||||||||| ||||||||||||||| |
|
|
| T |
54181195 |
tggttgcttggtatgacaatgaatggggttac |
54181164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University