View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9266_high_24 (Length: 275)
Name: NF9266_high_24
Description: NF9266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9266_high_24 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 7e-98; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 87 - 275
Target Start/End: Complemental strand, 49531647 - 49531459
Alignment:
| Q |
87 |
tattattgttaggagaataaatctaaaaggagagctcaacataaacgattagtctgttatttataagtctcgcttttaggtaagactagatagctaatgt |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49531647 |
tattattgttaggagaataaatctaaaaggatagctcaacataaacgattagtctgttatttataagtctcgcttttaggtaagactagatagctaatgt |
49531548 |
T |
 |
| Q |
187 |
agtgatccaaataattatcctttaaattaactatgttataggatttcaaccaaacacttatattttagcttaaatatattgtgttccat |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49531547 |
agtgatccaaataattatcctttaaattaactatgtgataggatttcaaccaaacacttatattttagcttaaatatattgtgttccat |
49531459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 49531707 - 49531674
Alignment:
| Q |
18 |
tatctaacattcataatttttgtgtatttatcac |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
49531707 |
tatctaacattcataatttttgtgtatttatcac |
49531674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University