View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9266_high_29 (Length: 226)
Name: NF9266_high_29
Description: NF9266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9266_high_29 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 19 - 226
Target Start/End: Complemental strand, 5895674 - 5895459
Alignment:
| Q |
19 |
tcaacttcttcttcgcactcaccacaaaattcccaatcaatctcttccactttgcactttctcttccattcccaacaccagccattccaaattccataca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5895674 |
tcaacttcttcttcgcactcaccacaaaattcccaatcaatctcttccactttgcactttctcttccattcccaacacctaccattccaaattccataca |
5895575 |
T |
 |
| Q |
119 |
aaccctaatgtcaaccatttctcttccgaacc--------ctaataccatggatatattctcaaaactcaaatatcttagtgccatcaacaaagacctcg |
210 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5895574 |
aaccctaatttcaaccatttctcttccgaacccgttctcgctaacaccgtggatatattctcaaaactcaaatatcttagtgccatcaacaaagacctcg |
5895475 |
T |
 |
| Q |
211 |
atttaaatcacgtttc |
226 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
5895474 |
attcaaatcacgtttc |
5895459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 23 - 84
Target Start/End: Complemental strand, 5881470 - 5881409
Alignment:
| Q |
23 |
cttcttcttcgcactcaccacaaaattcccaatcaatctcttccactttgcactttctcttc |
84 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||| ||||| || |||||||||| |
|
|
| T |
5881470 |
cttcttcttcgcactcaccacaaaatccccattcaatctcacacacttcgctctttctcttc |
5881409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University