View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9266_low_2 (Length: 1604)
Name: NF9266_low_2
Description: NF9266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9266_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 35; Significance: 0.0000000006; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000006
Query Start/End: Original strand, 990 - 1188
Target Start/End: Complemental strand, 4543555 - 4543357
Alignment:
| Q |
990 |
tctcaattgatgaggctattgaaatattagatgcagcatttctcttgaagattttgagaaaaccaaaacctgagattgagatggcaggggaaatggctcg |
1089 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||| || ||||| ||||| |||| | |||| ||| |||||| ||| |||| ||| |||||| |
|
|
| T |
4543555 |
tctcaattgatgaggccattgaaatatatgatgcatcagttctcatgaagtttttaaaaaaagataaagatgagatcgagttggcggggcggatggctta |
4543456 |
T |
|
| Q |
1090 |
tagaggtgcacttttgatgcttcaagcagatttgttaaaggagaaagggcgtgagctacttgtccaaagcaaacacaggttgcggatggcagaccttta |
1188 |
Q |
| |
|
||||||||| ||| |||||||||||||||| | ||| |||||||||| || |||||| ||||||||| | ||||| ||||||||||||||| |
|
|
| T |
4543455 |
tagaggtgcgcttatgatgcttcaagcagaaattctaagcaagaaagggcgcgaattacttgcacaaagcaaattgaagttgcagatggcagaccttta |
4543357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000006
Query Start/End: Original strand, 860 - 929
Target Start/End: Complemental strand, 4543676 - 4543607
Alignment:
| Q |
860 |
tcattgagccttgaggcagaagatgaactattcaaccgacccaaaaatggcgtgatatatgatgaggttt |
929 |
Q |
| |
|
|||||||||| ||||||| || |||||||| || ||| |||||||| || | ||||||||||||||||| |
|
|
| T |
4543676 |
tcattgagccgagaggcagtagttgaactatacacccggcccaaaaacggagcgatatatgatgaggttt |
4543607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 381 - 414
Target Start/End: Original strand, 28799983 - 28800016
Alignment:
| Q |
381 |
gttggagctcacacatttttaaatgtagagaagt |
414 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
28799983 |
gttggagctcacacatttttaaatgtagagaagt |
28800016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.0000001
Query Start/End: Original strand, 381 - 419
Target Start/End: Complemental strand, 33579221 - 33579183
Alignment:
| Q |
381 |
gttggagctcacacatttttaaatgtagagaagtatgat |
419 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
33579221 |
gttggagctcacacatttttaaatataaagaagtatgat |
33579183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University