View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9266_low_41 (Length: 347)
Name: NF9266_low_41
Description: NF9266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9266_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 17 - 199
Target Start/End: Complemental strand, 52824879 - 52824696
Alignment:
| Q |
17 |
atcaagttgagttatttaattcaattaaagatcttatttacaaaatgtgaaagaaatatttaatattttacactgatttatgaagaacgtacacaacccg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52824879 |
atcaagttgagttatttaattcaattaaagatcttatttacaaaatgtgaaagacatatttaatattttacactgatttatgaagaacgtacacaacccg |
52824780 |
T |
 |
| Q |
117 |
gttgagaggagcacaaaaacaaacaaaatattcatactagagctacatcaacgttttgtgtaca-ccctgtagtgtatacatct |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
52824779 |
gttgagaggagcacaaaaacaaacaaaatattcatactagagctacatcaacgttttgtgtacacccctgtagtgtatacatct |
52824696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 246 - 340
Target Start/End: Complemental strand, 52824640 - 52824546
Alignment:
| Q |
246 |
gatatgatagtttgatgatgtgaaaagaagagtgctagagagaaaatcagatgttgaatgaatgtatgaaatctaaagatatgtctatatcattg |
340 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52824640 |
gatatgacagtttgatgatgtgaaaagaagagtgctagagagaaaatcagatgttgaatgaatgtatgaaatctaaagatatgtctatatcattg |
52824546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University