View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9266_low_65 (Length: 236)
Name: NF9266_low_65
Description: NF9266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9266_low_65 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 14 - 236
Target Start/End: Complemental strand, 4712699 - 4712475
Alignment:
| Q |
14 |
atattttgtattcttttattggcaaatagtccggtaactaaactcacacac--taaatgtgaagaacttgaacattgttgattagaatttgcgcttctac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4712699 |
atattttgtattcttttattggcaaatagttcggtaactaaactcacacacactaaatgtgaagaacttgaacattgttgattagaatttgcgcttctac |
4712600 |
T |
 |
| Q |
112 |
atatcaaatgtctcgcaactttttatcatttgaactgcgcttactcaaattaattacaaaaacaaaaatgcttgtttccatataatgcaaataatacata |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4712599 |
atatcaaatgtctcgcaactttttatcatttgaactgcgcttactcaaattaattacaaaaacaaaaatgcttgtttccatataatgcaaataatacata |
4712500 |
T |
 |
| Q |
212 |
tatgtaacacatgttccacttttct |
236 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
4712499 |
tatgtaacacatgttccacttttct |
4712475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University