View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9267_high_15 (Length: 304)
Name: NF9267_high_15
Description: NF9267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9267_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 20 - 296
Target Start/End: Complemental strand, 439646 - 439372
Alignment:
| Q |
20 |
acgtggacggcaattcccggtgattctgtttgggactttagaggggacgggagaatcggctttgtgcctttctttattgtatctcaactttatactcttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
439646 |
acgtggacggcaattcccggtgattctgtttgggactttagaggggacgggagaatcggctttgtgtctttctttattgtatctcaactttatactcttc |
439547 |
T |
 |
| Q |
120 |
tcttttgtagtaatatagagaaatgtgaagctttaaatgagaaaatataaccacnnnnnnnnntgtttgagttcattcaatgttagaattgttatggtat |
219 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| |||||||| |||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
439546 |
tcttttgtagtagtatagagaaatgtgaagctttaaatgagaaa--ataaccacaaaaaaaaatgtttgagttcattgaatgttaaaattgttatggtat |
439449 |
T |
 |
| Q |
220 |
gaataagtctctactcgtctttgacaacactattttataaaccatgactagtgattagatttgaaatatgttctctg |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
439448 |
gaataagtctctactcgtctttgacaacactattttataaaccatgactagtgattagatttgaaatatgttctctg |
439372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University