View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9267_low_19 (Length: 386)

Name: NF9267_low_19
Description: NF9267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9267_low_19
NF9267_low_19
[»] chr5 (3 HSPs)
chr5 (239-386)||(39252878-39253025)
chr5 (18-163)||(39253050-39253196)
chr5 (195-230)||(39253019-39253054)
[»] chr1 (1 HSPs)
chr1 (227-371)||(15837953-15838097)
[»] chr4 (11 HSPs)
chr4 (229-348)||(2367689-2367808)
chr4 (222-340)||(2519153-2519271)
chr4 (226-350)||(12124748-12124872)
chr4 (229-348)||(2472019-2472138)
chr4 (233-293)||(2477499-2477559)
chr4 (226-350)||(12126804-12126928)
chr4 (259-340)||(2486264-2486345)
chr4 (226-350)||(2373251-2373374)
chr4 (248-340)||(2491074-2491166)
chr4 (232-345)||(2621177-2621290)
chr4 (200-256)||(2393707-2393763)


Alignment Details
Target: chr5 (Bit Score: 144; Significance: 1e-75; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 239 - 386
Target Start/End: Complemental strand, 39253025 - 39252878
Alignment:
239 gtgaggttggggaacctttcaaagagaagaggaagggaagggattgtttgatcggtgattgcgagggaggatcggagacggttgctgatggagagaaact 338  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39253025 gtgaggttggggaacctttcaaagagaagaggaagggaagggattgtttgatcggtgattgcgagggaggatcggagacggttgctgatggagagaaact 39252926  T
339 gtatggagacaaaagagacggacttcaaagtgtgattgtctgcgttgt 386  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||    
39252925 gtatggagacgaaagagacggacttcaaagtgtgattgtctgcgttgt 39252878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 18 - 163
Target Start/End: Complemental strand, 39253196 - 39253050
Alignment:
18 atagatcactcttgttggaattagccattttggtataagtgaaagagctcaaatttttcatctgtttggacatagctcgcaacctttttgcaagaaaaga 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39253196 atagatcactcttgttggaattagccattttggtataagtgaaagagctcaaatttttcatctgtttggacatagctcgcaacctttttgcaagaaaaga 39253097  T
118 gaggttgtggtgggagagactgagggatttgacg-aggtgtaaattt 163  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||    
39253096 gaggttgtggtgggagagactgagggatttgacgaaggtgtaaattt 39253050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 195 - 230
Target Start/End: Complemental strand, 39253054 - 39253019
Alignment:
195 aatttaggttaacttttttggatatgcgagtgaggt 230  Q
    ||||||||||||||||||||||||||||||||||||    
39253054 aatttaggttaacttttttggatatgcgagtgaggt 39253019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 57; Significance: 1e-23; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 227 - 371
Target Start/End: Complemental strand, 15838097 - 15837953
Alignment:
227 aggtcgagggatgtgaggttggggaacctttcaaagagaagaggaagggaagggattgtttgatcggtgattgcgagggaggatcggagacggttgctga 326  Q
    |||||||| ||||| ||||| ||||||||||  |||||   ||||| | ||||||||||||||||  |||||  ||||||| |||||||||||||| |||    
15838097 aggtcgagagatgttaggttagggaacctttggaagaggttaggaatgaaagggattgtttgatctatgattttgagggagaatcggagacggttggtga 15837998  T
327 tggagagaaactgtatggagacaaaagagacggacttcaaagtgt 371  Q
    |||||||||||||| ||||||| |  |||| |||||| |||||||    
15837997 tggagagaaactgtttggagaccatcgagagggacttgaaagtgt 15837953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 52; Significance: 1e-20; HSPs: 11)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 229 - 348
Target Start/End: Complemental strand, 2367808 - 2367689
Alignment:
229 gtcgagggatgtgaggttggggaacctttcaaagagaagaggaagggaagggattgtttgatcggtgattgcgagggaggatcggagacggttgctgatg 328  Q
    |||||||||||||||||||||||||||||  || ||  ||  |||| |||||||||||| |||||  ||||| | |||| |||||||||||||| |||||    
2367808 gtcgagggatgtgaggttggggaacctttggaaaaggcgataaaggaaagggattgttttatcggacattgctatggagaatcggagacggttggtgatg 2367709  T
329 gagagaaactgtatggagac 348  Q
    |||||||| ||| |||||||    
2367708 gagagaaattgtttggagac 2367689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 222 - 340
Target Start/End: Original strand, 2519153 - 2519271
Alignment:
222 gagtgaggtcgagggatgtgaggttggggaacctttcaaagagaagaggaagggaagggattgtttgatcggtgattgcgagggaggatcggagacggtt 321  Q
    |||||| || ||| ||||| | |||||||||||| ||||||||| || ||||| |||||||||||||||| | ||||| ||  |||||||| | ||||||    
2519153 gagtgatgttgagtgatgtaacgttggggaacctatcaaagagacgatgaaggaaagggattgtttgatctgagattgtgactgaggatcgaaaacggtt 2519252  T
322 gctgatggagagaaactgt 340  Q
    | ||||||| |||||||||    
2519253 ggtgatggacagaaactgt 2519271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 226 - 350
Target Start/End: Original strand, 12124748 - 12124872
Alignment:
226 gaggtcgagggatgtgaggttggggaacctttcaaagagaagaggaagggaagggattgtttgatcggtgattgcgagggaggatcggagacggttgctg 325  Q
    ||||||||||||| | ||||||||||||||||  |||||  |   |||| |||||||||||| ||| | |||||||| |||  || ||||||||||| ||    
12124748 gaggtcgagggatctaaggttggggaacctttggaagaggcggtcaaggaaagggattgtttcatcagagattgcgatggaaaattggagacggttggtg 12124847  T
326 atggagagaaactgtatggagacaa 350  Q
    ||||||||||| ||| |||||||||    
12124848 atggagagaaattgtttggagacaa 12124872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 229 - 348
Target Start/End: Original strand, 2472019 - 2472138
Alignment:
229 gtcgagggatgtgaggttggggaacctttcaaagagaagaggaagggaagggattgtttgatcggtgattgcgagggaggatcggagacggttgctgatg 328  Q
    |||||| || |||||||| ||||||||||| |||||  || ||||| |||||||||||| |  |  ||||| ||||||| ||| |||||| ||| |||||    
2472019 gtcgagagaggtgaggttagggaacctttcgaagaggtgatgaaggaaagggattgtttcacagtagattgtgagggagaatcagagacgattggtgatg 2472118  T
329 gagagaaactgtatggagac 348  Q
    |||| ||||||| |||||||    
2472119 gagaaaaactgtttggagac 2472138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 233 - 293
Target Start/End: Original strand, 2477499 - 2477559
Alignment:
233 agggatgtgaggttggggaacctttcaaagagaagaggaagggaagggattgtttgatcgg 293  Q
    |||||||||| ||| |||||||||| ||||||| || ||||||||||||| ||||||||||    
2477499 agggatgtgacgttagggaacctttgaaagagaggatgaagggaagggatggtttgatcgg 2477559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 226 - 350
Target Start/End: Original strand, 12126804 - 12126928
Alignment:
226 gaggtcgagggatgtgaggttggggaacctttcaaagagaagaggaagggaagggattgtttgatcggtgattgcgagggaggatcggagacggttgctg 325  Q
    ||||||||||||| | ||||||||||||||||  || ||  |   |||| |||||||| ||| ||| | || ||||| |||| || ||||||||||| ||    
12126804 gaggtcgagggatctaaggttggggaaccttttgaataggcggtcaaggaaagggattttttcatctgagactgcgatggagaataggagacggttggtg 12126903  T
326 atggagagaaactgtatggagacaa 350  Q
    ||||||||||| ||| |||||||||    
12126904 atggagagaaattgtttggagacaa 12126928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 259 - 340
Target Start/End: Original strand, 2486264 - 2486345
Alignment:
259 aaagagaagaggaagggaagggattgtttgatcggtgattgcgagggaggatcggagacggttgctgatggagagaaactgt 340  Q
    ||||||| || ||||| ||||||||||||  |||| ||||| ||  ||| |||||||||||||| ||||||| |||||||||    
2486264 aaagagacgatgaaggaaagggattgttttctcggagattgtgaccgagaatcggagacggttggtgatggacagaaactgt 2486345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 226 - 350
Target Start/End: Complemental strand, 2373374 - 2373251
Alignment:
226 gaggtcgagggatgtgaggttggggaacctttcaaagagaagaggaagggaagggattgtttgatcggtgattgcgagggaggatcggagacggttgctg 325  Q
    |||||||||||| |||||||||||||||||||  |||||  ||  |||| |||| ||||||| ||| |  ||||| | |||| |||||||| | ||| ||    
2373374 gaggtcgagggaggtgaggttggggaacctttggaagaggcgattaaggaaaggaattgttttatc-gacattgctatggagaatcggagatgattggtg 2373276  T
326 atggagagaaactgtatggagacaa 350  Q
    ||||||||||| ||| |||| ||||    
2373275 atggagagaaattgtttggaaacaa 2373251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 248 - 340
Target Start/End: Original strand, 2491074 - 2491166
Alignment:
248 gggaacctttcaaagagaagaggaagggaagggattgtttgatcggtgattgcgagggaggatcggagacggttgctgatggagagaaactgt 340  Q
    |||||||||||||||||| ||  |||| |||||||||||  ||||| ||||| ||  ||  |||||||||||||  ||||||| |||||||||    
2491074 gggaacctttcaaagagacgattaaggaaagggattgttgcatcggagattgtgaccgaaaatcggagacggtttgtgatggacagaaactgt 2491166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 232 - 345
Target Start/End: Complemental strand, 2621290 - 2621177
Alignment:
232 gagggatgtgaggttggggaacctttcaaagagaagaggaagggaagggattgtttgatcggtgattgcgagggaggatcggagacggttgctgatggag 331  Q
    |||||||||||  || |||||||| || |||||  |||||| | ||||||| |||| ||||| ||||| || |||| | || ||||||||| |||||||     
2621290 gagggatgtgatattagggaacctgtcgaagaggcgaggaatgaaagggatggttttatcggagattgtgatggagaaccgtagacggttggtgatggac 2621191  T
332 agaaactgtatgga 345  Q
    | ||||||| ||||    
2621190 aaaaactgtttgga 2621177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 200 - 256
Target Start/End: Complemental strand, 2393763 - 2393707
Alignment:
200 aggttaacttttttggatatgcgagtgaggtcgagggatgtgaggttggggaacctt 256  Q
    |||| ||||||||||||   ||||||||| ||||| ||||||||||| |||||||||    
2393763 aggtcaacttttttggagtagcgagtgagatcgagtgatgtgaggttagggaacctt 2393707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University