View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9267_low_32 (Length: 315)
Name: NF9267_low_32
Description: NF9267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9267_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 7e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 91 - 307
Target Start/End: Complemental strand, 56025708 - 56025490
Alignment:
| Q |
91 |
aatcaatgtgctgatgtggatttgtttaaacatggttgaaaccaaagagagtgtggatctgttaaattctcttttaatatcnnnnnnnn-atcaagggaa |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | |||| ||||| |
|
|
| T |
56025708 |
aatcaatgtgctgatgtggatttgtttaaacgtggttgaaaccaaagagagtgtggatctgttaaattctcttttaatttttttttttttatcacgggaa |
56025609 |
T |
 |
| Q |
190 |
aacaataaaaagttaagcgtccctcaaaaataaccgagaggtaaccaactgagtgatatttagcataggaggaggagacatc-acaccttacagaaatca |
288 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| ||||||||| |
|
|
| T |
56025608 |
aacaataaaaagttaagcatccctcaaaaataaccgagaggtaaccaactgagtgatatttagcagaggaggaggagacatctacaccttccagaaatca |
56025509 |
T |
 |
| Q |
289 |
acatttttaacaccaaact |
307 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
56025508 |
acatttttaacaccaaact |
56025490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 39 - 73
Target Start/End: Complemental strand, 56025759 - 56025725
Alignment:
| Q |
39 |
tccattatttgcttttaacaacaattaatgtgctt |
73 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
56025759 |
tccattatttgcttttaacaacaatcaatgtgctt |
56025725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University