View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9267_low_39 (Length: 236)
Name: NF9267_low_39
Description: NF9267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9267_low_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 20 - 224
Target Start/End: Original strand, 4410983 - 4411187
Alignment:
| Q |
20 |
cgaaggataggaataaatcgcgacgagagtcctatgtcagaagcttatgctgattcttcattgcaaaggcatgctgttgaatcaaagcaatctcaactct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4410983 |
cgaaggataggaataaatcgcgacgagagtcctatgtcagaagcttatgctgattcttcattgcaaaggcatgctgttgaatcaaagcaatctcaactct |
4411082 |
T |
 |
| Q |
120 |
tgatgcttctacagatggtacattgctaaccacttagattacattacattcatttggttttcgtaaaaccgtttacggtcctgattgcgttagtatatct |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | |
|
|
| T |
4411083 |
tgatgcttctacagatggtacattgctaaccacttagattacattacattcatttggttttcgtaaaaccgtttatggtcctgattgcgttagtatatgt |
4411182 |
T |
 |
| Q |
220 |
ctgct |
224 |
Q |
| |
|
||||| |
|
|
| T |
4411183 |
ctgct |
4411187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University