View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9267_low_40 (Length: 211)
Name: NF9267_low_40
Description: NF9267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9267_low_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 104 - 193
Target Start/End: Complemental strand, 43218634 - 43218549
Alignment:
| Q |
104 |
aagtgattaatttcttacttaccattaattggtaacataacatgttgctagctttttcaacacaaatgttgttagcatgacccttatagt |
193 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43218634 |
aagtgattaatttcttacttaccatt----ggtaacataacatgttgctagctttttcaacacaaatgttgttagcatgacccttatagt |
43218549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 48 - 98
Target Start/End: Complemental strand, 43218717 - 43218667
Alignment:
| Q |
48 |
tgatatgaaaaatgtcattgctgctcttcacggtcaggtaaatattggtaa |
98 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43218717 |
tgatatgaaaaatgtcattgctgttcttcacggtcaggtaaatattggtaa |
43218667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University