View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9267_low_41 (Length: 211)

Name: NF9267_low_41
Description: NF9267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9267_low_41
NF9267_low_41
[»] chr4 (2 HSPs)
chr4 (104-193)||(43218549-43218634)
chr4 (48-98)||(43218667-43218717)


Alignment Details
Target: chr4 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 104 - 193
Target Start/End: Complemental strand, 43218634 - 43218549
Alignment:
104 aagtgattaatttcttacttaccattaattggtaacataacatgttgctagctttttcaacacaaatgttgttagcatgacccttatagt 193  Q
    ||||||||||||||||||||||||||    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43218634 aagtgattaatttcttacttaccatt----ggtaacataacatgttgctagctttttcaacacaaatgttgttagcatgacccttatagt 43218549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 48 - 98
Target Start/End: Complemental strand, 43218717 - 43218667
Alignment:
48 tgatatgaaaaatgtcattgctgctcttcacggtcaggtaaatattggtaa 98  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||    
43218717 tgatatgaaaaatgtcattgctgttcttcacggtcaggtaaatattggtaa 43218667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University