View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9269_high_3 (Length: 335)
Name: NF9269_high_3
Description: NF9269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9269_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 120 - 330
Target Start/End: Complemental strand, 33554915 - 33554708
Alignment:
| Q |
120 |
gaatggatcagttgattgtgcattcagagaggtgatggtgggggagctccagaagcattagatgttgcaaatcgaaatttgtttgtgtgagttcagtcga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33554915 |
gaatggatcagttgattgtgcattcagagaggtgatggtgggggagctccagaagcattagatgttgcaaatcgaaatttgtttgtgtgagttcagtc-- |
33554818 |
T |
|
| Q |
220 |
aatttatatatgcaatgtatgaaactatactttcatgtcgnnnnnnnggttacatgggatgtagttcttacatgcttaagaacatatgttatattgacgg |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33554817 |
-atttatatatgcaatgtatgaaactatactttcatgtcgtttttttggttacatgggatgtagatcttacatgcttaagaacatatgttatattgacgg |
33554719 |
T |
|
| Q |
320 |
tctctgcttct |
330 |
Q |
| |
|
| |||| |||| |
|
|
| T |
33554718 |
tttctgtttct |
33554708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 18 - 62
Target Start/End: Complemental strand, 33555027 - 33554983
Alignment:
| Q |
18 |
gtaaccgatggcctaactacattgctgtagacttttacaaggtac |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33555027 |
gtaaccgatggcctaactacattgctgtagacttttacaaggtac |
33554983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University