View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9269_low_24 (Length: 201)
Name: NF9269_low_24
Description: NF9269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9269_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 3 - 186
Target Start/End: Complemental strand, 32670088 - 32669905
Alignment:
| Q |
3 |
ggagacatatcttgaggaatattgtaatgtgaagatgatgatgttaaagggaaattgagatttgaagcagatgatgaacctttaaggcataaaagtgcag |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32670088 |
ggagacatatcttgaggaatattgtaatgtgaagatgatgatgttaaagggaaattgagatttgaagcagatgatgaacctttaaggcataaaagtgcag |
32669989 |
T |
|
| Q |
103 |
catcataagctctagctgcagcttctgcagttgaataagaacctaaccaaattcttgttttttgatttggtgctctaatctctg |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32669988 |
catcataagctctagctgcagcttctgcagttgaataagaacctaaccaaattcttgttttttgatttggtgctctaatctctg |
32669905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 75 - 178
Target Start/End: Complemental strand, 24174161 - 24174058
Alignment:
| Q |
75 |
gatgaacctttaaggcataaaagtgcagcatcataagctctagctgcagcttctgcagttgaataagaacctaaccaaattcttgttttttgatttggtg |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24174161 |
gatgaacctttaaggcataaaagtgcagcatcataggctcttgcagcagcttctgcagttgaataagaacctaaccatattcttgttttttgatttggtg |
24174062 |
T |
|
| Q |
175 |
ctct |
178 |
Q |
| |
|
|||| |
|
|
| T |
24174061 |
ctct |
24174058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 138 - 187
Target Start/End: Complemental strand, 5681575 - 5681526
Alignment:
| Q |
138 |
taagaacctaaccaaattcttgttttttgatttggtgctctaatctctgc |
187 |
Q |
| |
|
|||||||||||||||||||||| | ||| |||||| ||||||||||||| |
|
|
| T |
5681575 |
taagaacctaaccaaattcttgatcttttgtttggttctctaatctctgc |
5681526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University