View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9271_low_7 (Length: 455)
Name: NF9271_low_7
Description: NF9271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9271_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 4e-82; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 4e-82
Query Start/End: Original strand, 240 - 413
Target Start/End: Complemental strand, 10425498 - 10425324
Alignment:
| Q |
240 |
cttaataaccgtcaaatatcttcccacatagaaacacaatataatccgcttctaattaagacttctactcactcattacccgggattgaa-tcgtcctgc |
338 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| ||| |
|
|
| T |
10425498 |
cttaataaccttcaaatatcttcccacatagaaacacaatataatccgcttctaattaagacttctactcactcattacccaggattgaaatcgtcatgc |
10425399 |
T |
|
| Q |
339 |
caagccgtcttgaaatcgtgtcactgaagaggagaacacccatgagaaatgggttatcatcaagattacactcta |
413 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10425398 |
caagccgtcttgaaatcgtgtcactgaagaggagaacacccatgagaaatgggttatcatcaagattacactcta |
10425324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 10426306 - 10426116
Alignment:
| Q |
1 |
ttctccacattattctctccttttcttctcacctatcccattttcccttatccttccaccctgtttttctactgtttcttctttacccttgcgttgagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10426306 |
ttctccacattattctctccttttcttctcacctatcccattttcccttatccttccaccctatttttctactgtttcttctttacccttgcgttgagtt |
10426207 |
T |
|
| Q |
101 |
ttgatcgacgaaaaattgatccatggaaaatgtcccttagctttttaaatccgctgaagaagtataggaatctgcttggaggtattattcttacattcac |
200 |
Q |
| |
|
||||||| ||||||| ||||| |||||||||||||| |||| ||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10426206 |
ttgatcg---------------atggaaattgtcc-----ctttttaaatccgc-gaagtagtttaggaatctgctgggaggtattattcttacattcac |
10426128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 64 - 109
Target Start/End: Complemental strand, 37686478 - 37686433
Alignment:
| Q |
64 |
tttttctactgtttcttctttacccttgcgttgagttttgatcgac |
109 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37686478 |
tttttctaccgtttcttctttacccttgcgttgagttttgatcgac |
37686433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 83; Significance: 4e-39; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 2 - 199
Target Start/End: Original strand, 24819463 - 24819656
Alignment:
| Q |
2 |
tctccacattattctctccttttcttctcac-ctatcccattttcccttatccttccaccctgtttttctactgtttcttctttacccttgcgttgagtt |
100 |
Q |
| |
|
||||||||||||| |||| ||||| |||||| ||||| ||| |||||| ||||||||||||| |||||||| |||||| ||| |||||| || |||||| |
|
|
| T |
24819463 |
tctccacattattttctctttttcctctcactctatcgcatcttccctcatccttccaccctatttttctaaggtttctccttgaccctttcgctgagtt |
24819562 |
T |
|
| Q |
101 |
ttgatcgacgaaaaattgatccatggaaaatgtcccttagctttttaaatccgctgaagaagtataggaatctgcttggaggtattattcttacattca |
199 |
Q |
| |
|
|||||| ||| |||||||||| | ||||||||||| ||||||||||||||| ||||||| |||||||||||| ||||||||||||||| ||||| |
|
|
| T |
24819563 |
ttgatcaacggaaaattgatcaacggaaaatgtcc-----ctttttaaatccgctcaagaagtttaggaatctgctgcgaggtattattcttatattca |
24819656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 64 - 106
Target Start/End: Original strand, 7497263 - 7497305
Alignment:
| Q |
64 |
tttttctactgtttcttctttacccttgcgttgagttttgatc |
106 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7497263 |
tttttctaccgtttcttctttacccttgcgttgagttttgatc |
7497305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 151 - 212
Target Start/End: Complemental strand, 18940976 - 18940915
Alignment:
| Q |
151 |
ccgctgaagaagtataggaatctgcttggaggtattattcttacattcaccgttccaattag |
212 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||| ||||| |||||||||| |
|
|
| T |
18940976 |
ccgctgaagaagatcaggaatctgcaaagaggtattattcttacaatcacccttccaattag |
18940915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University