View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9271_low_9 (Length: 377)
Name: NF9271_low_9
Description: NF9271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9271_low_9 |
 |  |
|
| [»] scaffold0048 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0048 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: scaffold0048
Description:
Target: scaffold0048; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 4 - 216
Target Start/End: Original strand, 16131 - 16343
Alignment:
| Q |
4 |
agtttggtgttactgaggcagctaacaataagatagttttcatgtgccctcctccaatgttggttctccggactgcagtgcctcccttgacaagcaccgg |
103 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
16131 |
agtttggtgtaactgaggcagctaacaataggatcgttttcatgtgccctcctccgatgttggttctccggactgcagtacctccctccacaagcaccgg |
16230 |
T |
 |
| Q |
104 |
tgaagatggaccagcttttcaagttgagcagtatttctgggcaaattagttattggatgtagttgttttatgggagggatgtgctggttgatatcgtcag |
203 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| | ||||| ||||||||||||||||||||| || |||||||||||| ||| |
|
|
| T |
16231 |
tgaagatggaccagcttttcaagttgagttgtatttctgggcaaattagattttggaagtagttgttttatgggagggaagtcctggttgatatcagcag |
16330 |
T |
 |
| Q |
204 |
tgtgatgttgtga |
216 |
Q |
| |
|
||||||||||||| |
|
|
| T |
16331 |
tgtgatgttgtga |
16343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0048; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 287 - 373
Target Start/End: Original strand, 16413 - 16499
Alignment:
| Q |
287 |
caacttaatgttttattaagtataagacttgatgtaatgttattgtgccattgaatgaaaagttaagtgttgtcttgatgtccatct |
373 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||| |||||| |||||||| |||||||||||| ||||| ||| ||||| |
|
|
| T |
16413 |
caacttaatgtttttttaagtagaagacttgatgtaatgttgttgtgctattgaatgtgaagttaagtgttatcttggtgttcatct |
16499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University